Significantly reduced DEL SUPPORT

[weishwu]

I ran Sniffles2 to call SVs from my amplicon ONT data. In one of the samples there is a strong ~34bp deletion that is carried by more than half of the reads:

As shown on IGV, this deletion starts from position 188 and ends at 221. However in the Sniffles2 output, this deletion was called as:

C392	181	Sniffles2.DEL.FS0	GTCATAGTATAACTTCGTATAATGTATGCTATACGAAGTTA	60	STDEV_POS	IMPRECISE;MOSAIC;SVTYPE=DEL;SVLEN=-40;END=221;SUPPORT=89

Sniffles2 shifted the start position to 181 (and the DEL length became 40, which may be caused by some reads that have a longer DEL at this locus). What is more concerning, the SUPPORT is 89, hugely lower than the truth as shown on IGV.

I filtered out the alignments that had mapq<20 so it can't be because of that.

Below are all the SVs called by Sniffles2. No neighboring DEL can explain the loss of SUPPORT:

Contig	POS	END	TYPE	SVLEN	SUPPORT
C392	44	92	DEL	-48	11
C392	48	48	INS	12	47
C392	48	48	INS	30	16
C392	48	48	INS	64	3
C392	48	58	DEL	-10	3667
C392	50	70	DEL	-20	108
C392	118	118	INS	46	6
C392	119	119	INS	81	1
C392	153	245	DEL	-92	5
C392	182	222	DEL	-40	89
C392	195	204	DEL	-9	158
C392	375	375	INS	117	2
C392	458	458	INS	9	45
C392	460	460	INS	27	12
C392	480	480	INS	53	8
C392	732	800	DEL	-68	4
C392	740	740	INS	64	1
C392	767	800	DEL	-33	48138

My command-line:

singularity run -B /nfs/ sniffles_v2.3.3.sif sniffles \
       --sample-id test \
       --reference C392.fa \
       --input C392_891_span.sorted.aligned.clean.bam \
       --vcf test.vcf \
       -t 2 \
       --minsvlen 10 \
       --mapq 20 \
       --min-alignment-length 100 \
       --no-qc \
       --output-rnames \
       --minsupport 2 

Any ideas? Thanks.

[weishwu]

Hi @hermannromanek , any thoughts/suggestions on this?

[fritzsedlazeck]

Thanks @weishwu
is it possuble to share the bam file with us ?
Or maybe make a screenshot of the IGV? My email: [email protected]

I suspect that there might be something else going on as Sniffles ignores some reads due to quality. Have you tried to just run with default parameters?

Thanks
Fritz

[hermannromanek]

Hi @weishwu

Sorry for the late reply - as Fritz suggested, sharing a (regional) bam file could help us identifying whats going on here. With the next version of sniffles we included the fix for an issue with with very clean cut deletions, so this may already be fixed as well, but we'd have to double check it.

Thanks,
Hermann

[weishwu]

Hi @fritzsedlazeck
I've shared a globus link with Fritz ([email protected]). The folder contains the BAM, index, and the VCF. Let me know if you want me to use a different way to share the data.
https://app.globus.org/file-manager?origin_id=af373541-899f-4eed-bae9-8ff738475f2d&origin_path=%2F
@hermannromanek Sorry I can't find your account on globus.
Thanks a lot for your help!

[hermannromanek]

Hi @weishwu

I registered through my Github account on globus - can you please also share the directory with me?

Thanks,
Hermann